Establishment of the Safe and Efficient CRISPR/Cas9-RNP Based Gene-Correction Platform of ELANE Mutations in iPSCs of Severe Congenital Neutropenia (CN) Patients with No Response to G-CSF and High Risk to Develop Leukemia

Severe congenital neutropenia (CN) is a monogenic pre-leukemia bone marrow failure syndrome characterized by an absolute neutrophil count (ANC) below 500 cells per microliter and recurrent, life-threatening bacterial infections. Treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) increases ANC in the majority of CN patients and dramatically improves the quality of life. However, some CN patients do not respond or respond only poorly to G-CSF and should be treated by bone marrow transplantation (BMT). In some cases, "G-CSF no-responder" CN patients fail to engraft bone marrow transplant and no therapeutic options for these patients remain. Therefore, establishment of the alternative therapeutic approaches for these patients is indispensable.

Many underlying genetic defects have been identified in CN. Autosomal dominant ELANE mutations have been identified in a majority of CN patient. Some ELANE mutations (e.g. p.A57V, p.C151Y, p.G214ter) are associated with no response or poor response to G-CSF therapy or high frequency of leukemia development.

In the present study, we established a DNA- and virus-free clinical-grade gene correction approach of these phenotypically severe ELANE mutations in induced pluripotent stem cells (iPSCs) of CN patients using CRISPR/Cas9-based technology. We used ribonucleoprotein (RNP) form of CRISPR Cas9 as a safe tool to correct ELANE mutations. For this, we generated and characterized iPSCs from ELANE -CN patients harboring p.C151Y and p.G214ter ELANE mutations. We used embryoid body (EB)-based hematopoietic differentiation method to evaluate granulocytic differentiation of CN-patients specific iPSCs. Granulocytic differentiation was studied by absolute live cell counts, FACS analysis of myeloid-specific surface markers expression levels, CFU assay, cell morphology of cytospin preparations and nitroblue tetrazolium (NBT) assay. We found markedly diminished granulocytic differentiation of ELANE -CN iPSCs (ELANE mutations p.C151Y and p.G214ter), as compared to healthy individuals. We designed and generated repair templates and specific Crispr-RNA (crRNA) for the fourth (GGGACGCCGCCTGGGCAACG) and fifth (GGACGAAGGAGGCAATTTCG) exons of ELANE for correction of mutations p.C151Y and p.G214R, respectively and made efficient Crispr-Cas9 Ribonucleoprotein (RNP) complexes to edit the mutations along with ssODN repair templates.

We further established gentle and efficient transfection of iPSCs from CN patients with ELANE -mutations specific-CRISPR/Cas9 ribonucleoprotein (RNP) complexes. We also developed simple and fast screening method for the selection of the ELANE gene corrected single iPSCs clones using restriction fragment length polymorphism (RFLP) analysis and Cas9 in vitro digestion technique. Selected clones were further analyzed for granulocytic differentiation. Up to now, we compared myeloid differentiation of iPSCs generated from healthy individuals with iPSCs from one CN- ELANE patient (p.C151Y) before- and after correction of ELANE mutation. We found that correction of ELANE mutation resulted in fully normalized granulocytic differentiation, that was in line with normalized levels of ELANE mRNA, correction of previously increased unfolded protein response (UPR)-activated gene expression, such as CHOP, ATF4, BIP, and reduction of elevated STAT5A levels in the ELANE corrected cells.

Taken together, we established a safe and efficient CRISPR/Cas9-RNP based ELANE gene-correction platform of iPSCs of ELANE -CN patients that may provide novel stem cell-based therapy for CN patients with high risk of leukemia development as well as for G-CSF-non-responsive patients. This platform may be also applied for treatment of patients with other monogenic bone marrow failure syndromes.